File Formats

FASTQ (.fastq, .fq)

Text-based format for storing both biological sequence data (usually nucleotide sequences) and their corresponding quality scores.

Each sequence entry contains four lines:

1. Sequence identifier with description
2. Raw sequence letters
3. Plus sign (optional description)
4. Quality scores encoded in ASCII characters

Element	Requirements	Description
@	@	Each sequence identifier line starts with @
<instrument>	Characters allowed: a–z, A–Z, 0–9 and underscore	Instrument ID
<run number>	Numerical	Run number on instrument
<flowcell ID>	Characters allowed: a–z, A–Z, 0–9	Flowcell ID
<lane>	Numerical	Lane number
<tile>	Numerical	Tile number
<x_pos>	Numerical	X coordinate of cluster
<y_pos>	Numerical	Y coordinate of cluster
<read>	Numerical	Read number. 1 can be single read or Read 2 of paired-end
<is filtered>	Y or N	Y if the read is filtered (did not pass), N otherwise
<control number>	Numerical	0 when none of the control bits are on, otherwise it is an even number. On HiSeq X systems, control specification is not performed and this number is always 0
<sample number>	Numerical	Sample number from sample sheet

Example.fastq

@071112_SLXA-EAS1_s_7:5:1:817:345
GGGTGATGGCCGCTGCCGATGGCGTC
AAATCCCACC
+
IIIIIIIIIIIIIIIIIIIIIIIIII
IIII9IG9IC
@071112_SLXA-EAS1_s_7:5:1:801:338
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI

SAM/BAM/CRAM (.sam, .bam, .cram)

• SAM (Sequence Alignment/Map): Text format for storing sequence alignments against a reference genome
• BAM: Binary version of SAM, compressed and indexed for faster processing
• CRAM: Highly compressed reference-based alternative to BAM, designed for long-term storage

FASTA (.fasta, .fa)

Simple text-based format for representing nucleotide or peptide sequences. Typically, FASTA is used to store reference data (such as those from curtated databases).

Each entry consists of:

• A description line (starts with ’>’)
• The sequence data on subsequent lines

Example.fasta

:filename: example.fasta
>Mus_musculus_tRNA-Ala-AGC-1-1 (chr13.trna34-AlaAGC)
GGGGGTGTAGCTCAGTGGTAGAGCGCGTGCTTAGCATGCACGAGGcCCTGGGTTCGATCC
CCAGCACCTCCA
>Mus_musculus_tRNA-Ala-AGC-10-1 (chr13.trna457-AlaAGC)
GGGGGATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCAAGAGGtAGTGGGATCGATG
CCCACATCCTCCA

VCF/BCF (.vcf, .bcf)

• VCF (Variant Call Format): Text file format for storing gene sequence variations
• BCF: Binary version of VCF

Contains information about:

• Genomic position of variants
• Reference and alternative alleles
• Quality scores
• Filter statuses
• Additional annotations

BED (.bed)

Browser Extensible Data format for defining genomic features.

Contains:

• Chromosome name
• Start position
• End position
• Optional fields (name, score, strand, etc.) Commonly used for displaying data tracks in genome browsers

Column number	Title	Definition	Required
1	chrom	Chromosome (e.g. chr3, chrY, chr2_random) or scaffold (e.g. scaffold10671) name	Yes
2	chromStart	Start coordinate on the chromosome or scaffold for the sequence considered (the first base on the chromosome is numbered 0 i.e. the number is zero-based)	Yes
3	chromEnd	End coordinate on the chromosome or scaffold for the sequence considered. This position is non-inclusive, unlike chromStart (the first base on the chromosome is numbered 1 i.e. the number is one-based)	Yes
4	name	Name of the line in the BED file	No
5	score	Score between 0 and 1000	No
6	strand	DNA strand orientation (positive [”+”] or negative [”-”] or ”.” if no strand)	No
7	thickStart	Starting coordinate from which the annotation is displayed in a thicker way on a graphical representation (e.g.: the start codon of a gene)	No
8	thickEnd	End coordinates from which the annotation is no longer displayed in a thicker way on a graphical representation (e.g.: the stop codon of a gene)	No
9	itemRgb	RGB value in the form R, G, B (e.g. 255,0,0) determining the display color of the annotation contained in the BED file	No
10	blockCount	Number of blocks (e.g. exons) on the line of the BED file	No
11	blockSizes	List of values separated by commas corresponding to the size of the blocks (the number of values must correspond to that of the “blockCount”)	No
12	blockStarts	List of values separated by commas corresponding to the starting coordinates of the blocks, coordinates calculated relative to those present in the chromStart column (the number of values must correspond to that of the “blockCount”)	No

GFF/GTF (.gff, .gtf)

• GFF (General Feature Format): Describes genes and other features of DNA, RNA, and protein sequences
• GTF (Gene Transfer Format): More specialized version of GFF

Contains:

• Feature coordinates
• Feature types
• Score
• Strand information
• Frame
• Attribute-value pairs

Column number	Title	Definition	Required
1	seqname	Name of the chromosome or scaffold; chromosome names can be given with or without the ‘chr’ prefix. Must be a standard chromosome name or an Ensembl identifier such as a scaffold ID, without additional content like species or assembly	Yes
2	source	Name of the program that generated this feature, or the data source (database or project name)	Yes
3	feature	Feature type name, e.g. Gene, Variation, Similarity	Yes
4	start	Start position of the feature, with sequence numbering starting at 1	Yes
5	end	End position of the feature, with sequence numbering starting at 1	Yes
6	score	A floating point value	Yes (use ’.’ if empty)
7	strand	Defined as + (forward) or - (reverse)	Yes (use ’.’ if empty)
8	frame	One of ‘0’, ‘1’ or ‘2’. ‘0’ indicates that the first base of the feature is the first base of a codon, ‘1’ that the second base is the first base of a codon, and so on	Yes (use ’.’ if empty)
9	attribute	A semicolon-separated list of tag-value pairs, providing additional information about each feature	Yes

WIG (.wig)

The WIG (wiggle) format is used for displaying continuous-valued data in track format. It is particularly useful for showing expression data, probability scores, and GC percentage.

WIG files be formatted in two main ways:

Fixed Step

fixedStep chrom=chrN start=pos step=stepInterval [span=windowSize]
dataValue
dataValue
dataValue

Required fields:

Field	Description
chrom	Chromosome name (e.g., chr1)
start	Starting position
step	Distance between starts of adjacent windows
dataValue	Numerical data value for each position

Optional fields:

Field	Description
span	Size of window (defaults to step size)

Variable Step

variableStep chrom=chrN [span=windowSize]
chromStart  dataValue
chromStart  dataValue
chromStart  dataValue

Required fields:

Field	Description
chrom	Chromosome name
chromStart	Start position of each window
dataValue	Numerical data value for each position

Optional fields:

Field	Description
span	Size of window (defaults to 1)

Example1.wig

fixedStep chrom=chr3 start=400601 step=100 span=100
11.0
22.0
33.0

Example2.wig

variableStep chrom=chr3 span=150
500701  5.0
500801  3.0
500901  8.0

BAI/CSI (.bai, .csi)

• BAI: Index format for BAM files
• CSI: Coordinate-sorted index format

These index files are typically required by common CLI tools

Enables:

• Random access to compressed files
• Quick retrieval of alignments
• Efficient genome browsing

bigWig/bigBed (.bw, .bb)

• bigWig: Binary format of .wig files
• bigBed: Binary format of .bed files

Advantages:

• Efficient random access
• Reduced memory usage
• Fast display in genome browsers